View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_37 (Length: 353)
Name: NF1249_low_37
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 102 - 278
Target Start/End: Complemental strand, 26233643 - 26233467
Alignment:
| Q |
102 |
atataggtgtgtatgtgacacataaggaatacaattatgaaacgtaagagataagagattggggaagtttggtgggaaatctctattctttagggatcag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26233643 |
atataggtgtgtatgtgacacataaggaatacaattatgaaacgtaagagataagagattggagaagtttggtgggaaagctctattctttagggatcag |
26233544 |
T |
 |
| Q |
202 |
tttgaaggggactaaattggaccatgtcgttgacagagaaagaaggttctatattatttgtatgactcatattgttg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26233543 |
tttgaaggggactaaattggaccatgtcgttgacagagagagaaggttctatattatttgtatgactcattttgttg |
26233467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University