View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_38 (Length: 344)
Name: NF1249_low_38
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 85 - 250
Target Start/End: Original strand, 5523031 - 5523196
Alignment:
| Q |
85 |
actcaagtgatgtgttatatatgaaataagctagggcattacaagaatgaataccttctgaataagcagaagaagtatgtcttcaagaagaagttaatgc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5523031 |
actcaagtgatgtgttatatatgaaataagctagggcattacaagaatgaataccttctgaataagcagaagaagtatgtcttcaagaagaagttaatgc |
5523130 |
T |
|
| Q |
185 |
tagctacatgtgatgatccagaagaaccaaaataagatcaagaattataagcaaacgggtgcctta |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5523131 |
tagctacatgtgatgatccagaggaaccaaaataagatcaagaattataagcaaacgggtgcctta |
5523196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University