View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_40 (Length: 341)
Name: NF1249_low_40
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 104 - 327
Target Start/End: Original strand, 36542912 - 36543134
Alignment:
| Q |
104 |
agcaatcgggttggttggggcattagagttgtccatttgaatgagaataatattatttagtgactgaaagttttctaagtatatggtgtttttgtgatat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36542912 |
agcaatcgggttggttggggcattagagttttacatttgaatgagaataatattatttattgtctgaaagttttctaagtatatggtgtttttgtgatat |
36543011 |
T |
|
| Q |
204 |
ttggcttttcacaatgcttgatattctttagtcatttgcnnnnnnnnggttgctacttcttaaatcatacttgggtttaatagtcttttatactctccta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36543012 |
ttggcttttcacaatgcttgatattctttagtcatttgctttttttt-gttgctacttcttaaatcatacttgggtttaatagtcttttatactctccta |
36543110 |
T |
|
| Q |
304 |
tattatttccctttttcttctacc |
327 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36543111 |
tattatttccctttttcttctacc |
36543134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University