View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_42 (Length: 340)
Name: NF1249_low_42
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 226 - 332
Target Start/End: Original strand, 10973998 - 10974104
Alignment:
| Q |
226 |
gtgccggacatatttttgattcccacttttcacagcctcatctccatttctttttggtgccatcacctcaaacctaagtttaagtttttataaattctag |
325 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10973998 |
gtgccggacatatttttggttcccactttccacagcctcatctccatttctttttggtgccatcacctcaaacctaagtttaagtttatataaattctag |
10974097 |
T |
 |
| Q |
326 |
aattatc |
332 |
Q |
| |
|
||||||| |
|
|
| T |
10974098 |
aattatc |
10974104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University