View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_43 (Length: 336)
Name: NF1249_low_43
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 83 - 240
Target Start/End: Complemental strand, 36804238 - 36804081
Alignment:
| Q |
83 |
atgaaacaaaaaatagttaaaggatcaaagtgaaaccacacaaatagtaaaaggatcaaatatataatctaactttttaaacggagctttgatacttgaa |
182 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
36804238 |
atgaaataaaaaatagttaagggatcaaagtgaaaccacacaaataataaaaggaccaaatatataatttaactttttaaatagagctttgatacttgag |
36804139 |
T |
|
| Q |
183 |
agggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36804138 |
agggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact |
36804081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University