View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_47 (Length: 328)
Name: NF1249_low_47
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 93 - 257
Target Start/End: Original strand, 6321867 - 6322031
Alignment:
| Q |
93 |
atattttaccaccatgttttgataagcttctagctggcttgttattgcgtccctctaagcgcccttggaagtccgatatgaatttgtacagttatagcaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321867 |
atattttaccaccatgttttgataagcttctagctggcttgttattgcgtccctctaagcgcccttggaagtccgatatgaatttgtacagttatagcaa |
6321966 |
T |
|
| Q |
193 |
taatgctgctgccccagcagcatttgatcagctcagaaaatatcctatgccgtctccttcatctc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
6321967 |
taatgctgctgccccagcagcatttgatcagctcagaaaatatcctatgccatctccttcgtctc |
6322031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University