View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_48 (Length: 327)
Name: NF1249_low_48
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 109 - 236
Target Start/End: Original strand, 5995174 - 5995301
Alignment:
| Q |
109 |
aggggtaggaccgcatggatacacaggttccaagcatgctgtgtggggattaacaaagaatgttgcagctgaattggggaaccacggaataagagtgaac |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995174 |
agggttaggaccgcatggatacacaggttccaagcatgctgtgtggggattaacaaagaatgttgcagctgaattggggaaccacggaataagagtgaac |
5995273 |
T |
 |
| Q |
209 |
tgtgtgtcaccttattgtgtcgcaacag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5995274 |
tgtgtgtcaccttattgtgtcgcaacag |
5995301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University