View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_48 (Length: 327)

Name: NF1249_low_48
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_48
NF1249_low_48
[»] chr3 (1 HSPs)
chr3 (109-236)||(5995174-5995301)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 109 - 236
Target Start/End: Original strand, 5995174 - 5995301
Alignment:
109 aggggtaggaccgcatggatacacaggttccaagcatgctgtgtggggattaacaaagaatgttgcagctgaattggggaaccacggaataagagtgaac 208  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5995174 agggttaggaccgcatggatacacaggttccaagcatgctgtgtggggattaacaaagaatgttgcagctgaattggggaaccacggaataagagtgaac 5995273  T
209 tgtgtgtcaccttattgtgtcgcaacag 236  Q
    ||||||||||||||||||||||||||||    
5995274 tgtgtgtcaccttattgtgtcgcaacag 5995301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University