View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_49 (Length: 327)
Name: NF1249_low_49
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 98 - 239
Target Start/End: Complemental strand, 1046599 - 1046458
Alignment:
| Q |
98 |
ctttcacctttcaagcaaccaccaagaaagactcaactatctccggaggcctaaagctgcatgcnnnnnnnnnnnnnnnnntatgtaatatgttagttga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1046599 |
ctttcacctttcaagcaaccaccaagaaagactcaactatctccggaggcctaaagctgcatgcaaaataaaaataaaaaatatgtaatatgttagttga |
1046500 |
T |
|
| Q |
198 |
attgcataaactcgataacttttaagtcaattttcccatata |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1046499 |
attgcataaactcgataacttttaagtcaattttcccatata |
1046458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University