View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_50 (Length: 326)
Name: NF1249_low_50
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 96 - 229
Target Start/End: Complemental strand, 17319925 - 17319792
Alignment:
| Q |
96 |
caaaggataagttagtccctctagcaaaagctaaattccatggactgggtgagccaaacaccgcacccaaatcatctttttaagcactcgttcgggttcc |
195 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17319925 |
caaaggataagttagtctccctagcaaaagctaaattccatggactgggtgagccaaacaccgcacccaaatcatctttttaagcactcgttcgggttcc |
17319826 |
T |
|
| Q |
196 |
aactccactcatagaagatacaaggagatatatt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
17319825 |
aactccactcatagaagatacagggagatatatt |
17319792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University