View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_52 (Length: 325)
Name: NF1249_low_52
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 98 - 238
Target Start/End: Complemental strand, 1046599 - 1046459
Alignment:
| Q |
98 |
ctttcacctttcaagcaaccaccaagaaagactcaactatctccggaggcctaaagctgcatgcnnnnnnnnnnnnnnnnntatgtaatatgttagttga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1046599 |
ctttcacctttcaagcaaccaccaagaaagactcaactatctccggaggcctaaagctgcatgcaaaataaaaataaaaaatatgtaatatgttagttga |
1046500 |
T |
|
| Q |
198 |
attgcataaactcgataacttttaagtcaattttcccatat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1046499 |
attgcataaactcgataacttttaagtcaattttcccatat |
1046459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University