View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_55 (Length: 323)
Name: NF1249_low_55
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 15873055 - 15873092
Alignment:
| Q |
268 |
attgcccatgtacttcaaatcggtgctcatcttttctt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15873055 |
attgcccatgtacttcaaatcggtgctcatcttttctt |
15873092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 111 - 167
Target Start/End: Original strand, 15872853 - 15872909
Alignment:
| Q |
111 |
atctaaatccctctccttcttaattgtttttctcattgctttctttttcttccttat |
167 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
15872853 |
atctaaatctctccccttcttaattgtttttcacactgctttctttctcttccttat |
15872909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University