View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_60 (Length: 321)
Name: NF1249_low_60
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 46411195 - 46410976
Alignment:
| Q |
5 |
tttaaacgttatttttgtgaaacttcaaaaagacgatgaaccaatttcaaaatatgaaaatatggagtaattttcaaattatgaaaaattgtagggacca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46411195 |
tttaaacgttatttttgtgaaacttcaaaaagacaatgaaccaatttcaaaatatgaaaatagggagcaattttcaaattatgaaaaattgtagggacca |
46411096 |
T |
|
| Q |
105 |
aattacaacttttgaaattttttagggccaatttgagatattgtctgttgtctattggctgcacataggtgtaaaggcaaatcaaacaaagcttggcatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46411095 |
aattacaacttttgaaattttttagggccaatttgagatattgtctgttgtctattggctgcacataggtgtaaaggcaaatcaaac-aagcttggcatt |
46410997 |
T |
|
| Q |
205 |
tcagattgatggtcagatgtg |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46410996 |
tcagattgatggtcagatgtg |
46410976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University