View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_66 (Length: 317)
Name: NF1249_low_66
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 33498105 - 33497897
Alignment:
| Q |
16 |
ataattgaaccgctgcaaaggccaatttgtggttgagccgttcggtttgatttttaaagcactaaaatgatgcataatatctcacatttcagcgtgtatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33498105 |
ataattgaaccgctgcaaaggccaatttgtggctgagccgttcggtttgatttttaaagcactaaaatgatgcataatatctcacatttcagcgcgtatc |
33498006 |
T |
|
| Q |
116 |
gtgactaacttgttctctccacttatctgatgtgtgcaggtttttgtagataatcatgatttccataaagagcttgagtaattttatatggttcaccgcg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33498005 |
gtgactaacttgttctctccacttatctgatgtgtgcaggtttttgtagataatcatgatttccataaagagcttgagtaattttatatggttcaccgcg |
33497906 |
T |
|
| Q |
216 |
actgtcttg |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
33497905 |
actgtcttg |
33497897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University