View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_67 (Length: 316)
Name: NF1249_low_67
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 12751388 - 12751185
Alignment:
| Q |
19 |
ccttccatgggacaagaggtcatatgagaatgatcttcctgatcatgaccttacaagcataggaaacaccaacaaacatgtggtggttgtcatggatgca |
118 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12751388 |
ccttccacgggacaagaggtcacatgagaatgatcttcctgatcatgaccttacaagcacaggaaacaccaacaaacatgtggtggttgtcatggatgca |
12751289 |
T |
 |
| Q |
119 |
atgacagagttctcaacagagcctcttcaacgggcacttgacaatgtcgttaccgtagcgtgcgccgtcacactcttggggtcatgccatgtctcaacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12751288 |
atgacagagttctcaacagagcctcttcaacgggcacttgacaatgtcgttaccatagcgtgcgctgtcacactcttggggtcatgccatgtctcaacaa |
12751189 |
T |
 |
| Q |
219 |
tcct |
222 |
Q |
| |
|
|||| |
|
|
| T |
12751188 |
tcct |
12751185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 12814349 - 12814149
Alignment:
| Q |
20 |
cttccatgggacaagaggtcatatgagaatgatcttcctgatcatgaccttacaagcataggaaacaccaacaaacatgtggtggttgtcatggatgcaa |
119 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814349 |
cttccacgggacaagaggtcacatgagaatgatcttcctgatcatgaccttacaagcacaggaaacaccaacaaacatgtggtggttgtcatggatgcaa |
12814250 |
T |
 |
| Q |
120 |
tgacagagttctcaacagagcctcttcaacgggcacttgacaatgtcgttaccgtagcgtgcgccgtcacactcttggggtcatgccatgtctcaacaat |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814249 |
tgac--agttctcaacagagcctcttcaacgggcacttgacaatgtcgttaccgtagcgtgcgctgtcacactcttggggtcatgccatgtctcaacaat |
12814152 |
T |
 |
| Q |
220 |
cct |
222 |
Q |
| |
|
||| |
|
|
| T |
12814151 |
cct |
12814149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University