View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_71 (Length: 309)
Name: NF1249_low_71
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_71 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 21667 - 21386
Alignment:
| Q |
11 |
catagggcataaggtattatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21667 |
catagggcataaggtattatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatg |
21568 |
T |
 |
| Q |
111 |
attctgttttcttcttctattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgtttt------------gaggaccctttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21567 |
attctgttttcttcttctattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgttttgagggtttttttgaggaccctttt |
21468 |
T |
 |
| Q |
199 |
ggatttgaaagaatgagtagttgtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatgga |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467 |
ggatttgaaagaatgagtagttgtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatgga |
21386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 25080630 - 25080571
Alignment:
| Q |
221 |
gtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatgga |
280 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25080630 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttccttgtttaagatgga |
25080571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 25138599 - 25138540
Alignment:
| Q |
221 |
gtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatgga |
280 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25138599 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttccttgtttaagatgga |
25138540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University