View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_72 (Length: 308)
Name: NF1249_low_72
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 31 - 239
Target Start/End: Original strand, 9684312 - 9684525
Alignment:
| Q |
31 |
tactctatcattataatgaagatcgatgatgataataactactttttagaaaagaaaagtaatagtagttggtggaagaatg--aaaaaataatatgaag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9684312 |
tactctatcattataatgaagatcgatgatgataataactactttttagaaaagaaaagtaatagtagttggtggaagaatgaaaaaaaataatatgaag |
9684411 |
T |
|
| Q |
129 |
attgatgaagaagttttaaggtaatca---atgtacaataaaaggggcattgatcctaccctagcactatacccttttggtttacatgtggagacacaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9684412 |
attgatgaagaagttttaaggtaatcaaatatgtgcaataaaaggggcattgatcctaccctagcactatacccttttggtttacatgtggagacacaat |
9684511 |
T |
|
| Q |
226 |
gatactcaagtatt |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9684512 |
gatactcaagtatt |
9684525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University