View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_73 (Length: 307)
Name: NF1249_low_73
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 93 - 232
Target Start/End: Complemental strand, 37278886 - 37278747
Alignment:
| Q |
93 |
ctcggttgattagtgataatgttaaaggagtctctactcctcgtttaatttcttgttagnnnnnnnnnnnnggacataggcccttctgtatccctaaaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| | |||||||||||| |
|
|
| T |
37278886 |
ctcggttgattagtgataatgttaaaggagtctctactcctcgtttaatttcttgttagtttttcttttttggacattggcccttttatatccctaaaaa |
37278787 |
T |
 |
| Q |
193 |
atatcctcatgacccttaaaattttgacgacgtaattcat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37278786 |
atatcctcatgacccttaaaattttgacgacgtaattcat |
37278747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University