View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_76 (Length: 300)
Name: NF1249_low_76
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 78 - 236
Target Start/End: Complemental strand, 29922803 - 29922645
Alignment:
| Q |
78 |
atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29922803 |
atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact |
29922704 |
T |
|
| Q |
178 |
tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29922703 |
tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgat |
29922645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University