View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_77 (Length: 300)
Name: NF1249_low_77
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 106 - 222
Target Start/End: Original strand, 3878957 - 3879073
Alignment:
| Q |
106 |
tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3878957 |
tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt |
3879056 |
T |
|
| Q |
206 |
ggttttcttgattcatc |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3879057 |
ggttttcttgattcatc |
3879073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 104 - 222
Target Start/End: Original strand, 3864958 - 3865076
Alignment:
| Q |
104 |
gctgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatc |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
3864958 |
gctgcaacttcatgccctcaactagtgaaactggacatgcgtaattgttcttgtgtcagcgatgaaacactgcgtgaaatagcacaacattgtcctaatc |
3865057 |
T |
|
| Q |
204 |
ttggttttcttgattcatc |
222 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
3865058 |
ttggttttcttgatgcatc |
3865076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University