View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_77 (Length: 300)

Name: NF1249_low_77
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_77
NF1249_low_77
[»] chr1 (2 HSPs)
chr1 (106-222)||(3878957-3879073)
chr1 (104-222)||(3864958-3865076)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 106 - 222
Target Start/End: Original strand, 3878957 - 3879073
Alignment:
106 tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3878957 tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt 3879056  T
206 ggttttcttgattcatc 222  Q
    |||||||||||||||||    
3879057 ggttttcttgattcatc 3879073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 104 - 222
Target Start/End: Original strand, 3864958 - 3865076
Alignment:
104 gctgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatc 203  Q
    ||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| || |||||||||||||    
3864958 gctgcaacttcatgccctcaactagtgaaactggacatgcgtaattgttcttgtgtcagcgatgaaacactgcgtgaaatagcacaacattgtcctaatc 3865057  T
204 ttggttttcttgattcatc 222  Q
    |||||||||||||| ||||    
3865058 ttggttttcttgatgcatc 3865076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University