View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_87 (Length: 276)
Name: NF1249_low_87
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 134
Target Start/End: Complemental strand, 2147007 - 2146903
Alignment:
| Q |
30 |
aattataggttggaatttactaacaagactcaccgcatataattgtagagttattgattcgagggaatccactcctcctaaatgaacttattattaacaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2147007 |
aattataggttggaatttactaacaagactcaccgcatataattgtagagttattcattcgagggaatccactcctcctaaatgaacttattattaacaa |
2146908 |
T |
|
| Q |
130 |
aactc |
134 |
Q |
| |
|
||||| |
|
|
| T |
2146907 |
aactc |
2146903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 66 - 122
Target Start/End: Complemental strand, 2143048 - 2142992
Alignment:
| Q |
66 |
atataattgtagagttattgattcgagggaatccactcctcctaaatgaacttatta |
122 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2143048 |
atataattgtagagttattcatttgagggaatccactcttcctaaatgaacttatta |
2142992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University