View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250-Insertion-1 (Length: 301)
Name: NF1250-Insertion-1
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250-Insertion-1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 233 - 276
Target Start/End: Complemental strand, 14342420 - 14342377
Alignment:
| Q |
233 |
ctattgaaattccttttattgcgcctataacaaccaacacatat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14342420 |
ctattgaaattccttttattgcgcctataacaaccaacacatat |
14342377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University