View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250-Insertion-8 (Length: 50)
Name: NF1250-Insertion-8
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 49872003 - 49872043
Alignment:
| Q |
8 |
atgtcattggtagccaattccttgtagagtgttgagttgtg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49872003 |
atgtcattggtagccaattccttgtagagtgttgagttgtg |
49872043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 49866072 - 49866114
Alignment:
| Q |
8 |
atgtcattggtagccaattccttgtagagtgttgagttgtgga |
50 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
49866072 |
atgtcattggtagctaattccttgtagagttttgagttatgga |
49866114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University