View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1250-Insertion-8 (Length: 50)

Name: NF1250-Insertion-8
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1250-Insertion-8
NF1250-Insertion-8
[»] chr4 (2 HSPs)
chr4 (8-48)||(49872003-49872043)
chr4 (8-50)||(49866072-49866114)


Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 49872003 - 49872043
Alignment:
8 atgtcattggtagccaattccttgtagagtgttgagttgtg 48  Q
    |||||||||||||||||||||||||||||||||||||||||    
49872003 atgtcattggtagccaattccttgtagagtgttgagttgtg 49872043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 49866072 - 49866114
Alignment:
8 atgtcattggtagccaattccttgtagagtgttgagttgtgga 50  Q
    |||||||||||||| ||||||||||||||| ||||||| ||||    
49866072 atgtcattggtagctaattccttgtagagttttgagttatgga 49866114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University