View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12500_low_19 (Length: 315)
Name: NF12500_low_19
Description: NF12500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12500_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 34 - 298
Target Start/End: Complemental strand, 51806240 - 51805976
Alignment:
| Q |
34 |
ctctaatgaaagagtctctctcaggaaactacccttttgattggggtgtaagcaaagtggataaaccaatctgcgacttcaccggaatcacctgtgacaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806240 |
ctctaatgaaagagtctctctcaggaaactacccttttgattggggtgtaagcaaagtggataaaccaatctgcgacttcaccggaatcacctgtgacaa |
51806141 |
T |
|
| Q |
134 |
caaaggagacatcataagtcttgatttttcaggttggtcatcactttccggaaacttcccatcaaatatttgctcttaccttccaaatttacgtgtccta |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806140 |
caaaggagacatcataagtcttgatttttcaggttggtcatcactttccggaaacttcccgtcaaatatttgctcttaccttccaaatttacgtgtccta |
51806041 |
T |
|
| Q |
234 |
aacctcggtaatacaaaattcaagttcccaacaaacagcataatcaactgttctcacttagaact |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806040 |
aacctcggtaatacaaaattcaagttcccaacaaacagcataatcaactgttctcacttagaact |
51805976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University