View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12500_low_20 (Length: 297)
Name: NF12500_low_20
Description: NF12500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12500_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 22 - 282
Target Start/End: Complemental strand, 27638325 - 27638061
Alignment:
| Q |
22 |
tgtttctcctaaaacttttggagttgttattgcaaaatgtagagtcacattaatcataactcaaaagtgagttttgttagg---agacaaaccaacaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27638325 |
tgtttctcctaaaacttttggagttgttattgcaaaatgtagagtcacattaatcataactcaaaagtgagttttgttaggagaagacaaaccaacaata |
27638226 |
T |
|
| Q |
119 |
ttgataatagtctagcaagagcacgtcgttattaccctagtcactaa-attttttattataaccctctgttattgttaaaataataatattgtgatgtaa |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27638225 |
ttgctaatagtctagcaagagcacgtcgttattaccctagtcactaattttttttattataaccctctgttattgttaaaataataatattgtgatgtga |
27638126 |
T |
|
| Q |
218 |
tttcatatagtatttatattattnnnnnnntgcattgccctaatttgatagattcttatatttgt |
282 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27638125 |
tttcatatagtatttatattattaaaaaaatacattgccctaatttgatagattcttatatttgt |
27638061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University