View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12500_low_29 (Length: 214)
Name: NF12500_low_29
Description: NF12500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12500_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 41220602 - 41220424
Alignment:
| Q |
19 |
tgggatgaattagaggattatcgcccaattccttattgtaagtgctctattgcatgttcatgtggtgggtatacatccatgaaagaatttcgtgagcaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41220602 |
tgggatgaattagaggattatcgcccaattccttattgtaagtgctctattgcatgttcatgtggtgggtatacatccatgaaagaatttcgtgagcaag |
41220503 |
T |
 |
| Q |
119 |
actatgtcattcgatttctcaagggtttgaacgagcgtttttcccacgtcaaatcacatataatgtccatggatccttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41220502 |
actatgtcattcgatttctcaagggtttgaacgagcgtttttcccacgtcaaatcacatataatgtccatggatccttt |
41220424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University