View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12500_low_5 (Length: 459)
Name: NF12500_low_5
Description: NF12500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12500_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 15 - 438
Target Start/End: Complemental strand, 44575577 - 44575154
Alignment:
| Q |
15 |
ttcactgtaatggatcagcagagcacatttggtgtgcttcaagttatacaaactgataggtctattggatctcacttcaaggttccaccaggatggatga |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575577 |
ttcattgtaatggatcagcagagcacatttggtgtgcttcaagttatacagactgataggtctattggatctcacttcaaggttccaccaggatggatga |
44575478 |
T |
|
| Q |
115 |
acttgatatcaatgacatcactttcattttggatatgcatttatgagtgtatctaccttcctataatgaggataatcaataaaagggctacaagaagaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575477 |
acttgatatcaatgacatcactttcattttggatatgcatttatgagtgtatctaccttcctataatgaggataatcaataaaagggctacaagaagaat |
44575378 |
T |
|
| Q |
215 |
gagcatgggatgcagaatcagaattgggatattattatctatcctatgcatgttggtagctgcagttattgagaaaaagcgtcgtgactcggctttgaaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44575377 |
gagcatgggatgcagaatcagaattgggatattattatctatcctatgcatgttggtagctgcagttgttgagaaaaagcgtcgtgactcggctttgaaa |
44575278 |
T |
|
| Q |
315 |
cacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagcctttgctgctgttgctataatggaat |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575277 |
cacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagcctttgctgctgttgctataatggaat |
44575178 |
T |
|
| Q |
415 |
tctttacccttcaagtgccggagt |
438 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44575177 |
tctttacccttcaagtgccggagt |
44575154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University