View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12500_low_9 (Length: 428)
Name: NF12500_low_9
Description: NF12500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12500_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 3 - 413
Target Start/End: Complemental strand, 33126786 - 33126376
Alignment:
| Q |
3 |
tggagtagcatagggaagtgtaggaggggtaggaggtggaggaatttttatccctatgctcactttgattattggttttgatccaaagtcttctacagcc |
102 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33126786 |
tggagcagcattgggaagtgtaggaggggtaggaggtggaggaatttttatccctatgctcactttgatcattggttttgatccaaagtcttctacagcc |
33126687 |
T |
 |
| Q |
103 |
ctctctaagtgttagtatatttctatcttatgtttattcattcttgttagatatatagtcgatgtttggatttacgtttcaattatctttctcacgtctc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126686 |
ctctctaagtgttagtatatttctatcttatgtttattcattcttgttagatgtatagtcgatgtttggatttacgtttcaattatctttctcacgtctc |
33126587 |
T |
 |
| Q |
203 |
aaatacagttttggacctgaaattggtgaagctacaaatagtagcatgtggctggtcgcgattcagaagctatatgaactagcttctgaatgcggttcca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126586 |
aaatacagttttggacctgaaattggtgcagctacaaatagtagcatgtggttggctgcgattcagaagctatatgaactagcttctgaatgcggttcca |
33126487 |
T |
 |
| Q |
303 |
aacacacaatacatgcattctttctaaatttttatcgatgtgtcccaattcattttcgaaagctctttcaaatactctggctgctatctttgttattgca |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33126486 |
aacacacaatacatgcattctttctaaatttttatcgatgtgtcccaattcattttcgaaagcactttcaaatgctctggctgctatctttgttattgca |
33126387 |
T |
 |
| Q |
403 |
ggtatgattac |
413 |
Q |
| |
|
||||||||||| |
|
|
| T |
33126386 |
ggtatgattac |
33126376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 15 - 102
Target Start/End: Original strand, 7568641 - 7568728
Alignment:
| Q |
15 |
gggaagtgtaggaggggtaggaggtggaggaatttttatccctatgctcactttgattattggttttgatccaaagtcttctacagcc |
102 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||||||| |||||||||| ||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
7568641 |
gggaagtgttggaggtgtaggaggtggtggaatttttgtccctatgcttgctttgatcattggctttgatcccaagtcttctacagcc |
7568728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 32663699 - 32663744
Alignment:
| Q |
158 |
tagtcgatgtttggatttacgtttcaattatctttctcacgtctca |
203 |
Q |
| |
|
||||| |||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
32663699 |
tagtcaatgtttggatttacatttgaattgtctttctcacgtctca |
32663744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University