View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12501_high_17 (Length: 216)
Name: NF12501_high_17
Description: NF12501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12501_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 48066058 - 48066271
Alignment:
| Q |
1 |
atacaaataataacactcttgtcactgctctctct------------caattagtgttgcgataacaagcttggttggttttatgctcaaccatttcttc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48066058 |
atacaaataataacactcttgtcactgctctctctctctctcactctcaattagtgttgtaataataagcttggttggttttatgctcaaccatttcttc |
48066157 |
T |
 |
| Q |
89 |
gttttgggagattctttatagtggacagtggtggtaacaatgattctgttgctactactgccatagttgacgctactcatccgtatggtcttgattaacc |
188 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48066158 |
gttttgggagattctttatagtggaca---gtggtaacaatgattttgttgctaccactgccatagttgacgctactcatccgtatggtcttgattaacc |
48066254 |
T |
 |
| Q |
189 |
agacatacccagtgaac |
205 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
48066255 |
agacatacctagtgaac |
48066271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University