View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12501_low_25 (Length: 227)
Name: NF12501_low_25
Description: NF12501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12501_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 174
Target Start/End: Original strand, 37162144 - 37162302
Alignment:
| Q |
13 |
gagatgaaaactattttactcgagcacttcccaaaaaagcaatatcaattcaatgttttctaaaatcatccttgtctcttaccaaataaaattcaaacat |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37162144 |
gagatgaaaactaatttactcgagcacttcccaaaaaagcaatatcaattcaatgttttctaaaatcatccttgtctcttacaaaataaaattcaaacat |
37162243 |
T |
|
| Q |
113 |
gcaatgagagggtaaaaaatgagccaagtagaagaatctaaaaaaccttacaaaatgaatag |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37162244 |
gcaatgagagggtaaaaaatgagccaagt---agaatctaaaaaaccttacaaaatgaatag |
37162302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University