View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12501_low_9 (Length: 379)
Name: NF12501_low_9
Description: NF12501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12501_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 17 - 361
Target Start/End: Original strand, 47366980 - 47367324
Alignment:
| Q |
17 |
tgaaagctgccaccactggggatggttgaaccccgaaccgggtaccgccaaatgcaattttagcagttggattgggagctgaagaagcatacttctttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47366980 |
tgaaagctgccaccactggggatggttgaaccccgaaccgggtaccgccaaatgcaattttagcagttggattgggagctgaagaagcatacttctttat |
47367079 |
T |
 |
| Q |
117 |
ttcattgcttgctttctctcccaaagctgctgcagggaggagaaaggagtcagcaactagctcttcaccataatcttggttgtttgctaaaatcatccca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367080 |
ttcattgcttgctttctctcccaaagctgctgcagggaggagaaaggagtcagcaactagctcttcaccataatcttggttgtttgctaaaatcatccca |
47367179 |
T |
 |
| Q |
217 |
attcctcctgcgcgtttgaccaccaaactcttttcagctctaggatttcctcctcggtcacatatcactatttttcctgaaactttgctaggaatcaaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367180 |
attcctcctgcgcgtttgaccaccaaactcttttcagctctaggatttcctcctcggtcacatatcactatttttcctgaaactttgctaggaatcaaac |
47367279 |
T |
 |
| Q |
317 |
tatctgtgctgcacaggttatcactggaatcctggctgacgttag |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367280 |
tatctgtgctgcacaggttatcactggaatcctggctgacgttag |
47367324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University