View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_high_12 (Length: 222)
Name: NF12502_high_12
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 24081326 - 24081514
Alignment:
| Q |
18 |
gtaacatctgcaatttctgatctataaaaacatatattagtaattcctat-gctacttgagaggacaataaaacttatatttaatatgttttaaattccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||| |||||||||||||||||| | |
|
|
| T |
24081326 |
gtaacatctgcaatttctgatctataaaaacatatattagtaattcctattgctacttgagacgacaacaaaacttatctttaatatgttttaaatttgg |
24081425 |
T |
|
| Q |
117 |
gtgaaagttttatcaaaacataaaaacatatatcattggttttattatgctattgctaccataccatttcagtctttcgatgttctcctat |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24081426 |
gtgaaagttttatcaaaacataaaaac--atatcattggttttattatgctattgctactataccatttcagtctttcgatgttctcctat |
24081514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University