View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_high_13 (Length: 210)
Name: NF12502_high_13
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 2875050 - 2875238
Alignment:
| Q |
1 |
gcatggtttcaacttttttattttcttctctctctctatgatatttaggtttctataatggcaacaattactatgacactttttctgcgaacccatatgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875050 |
gcatggtttcaactttttcattttcttctc--tctctatgatatttaggtttctataatggcaacaattactatgacactttttctgcgaacccatatgc |
2875147 |
T |
|
| Q |
101 |
acaaagaaacagtgattgatggacaaattcattttggtgctttatatttctcattgataatgctcatgtttaacggaactattgagcttac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2875148 |
acaaagaaacagtgattgatggacaaattcattttggtgctttatatttctcattgataatgctcatgtttaatggaactattgagcttac |
2875238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University