View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_low_10 (Length: 254)
Name: NF12502_low_10
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 42097569 - 42097809
Alignment:
| Q |
14 |
cataggcataggtccaatttgtgacgacctagagctcaagtttgtaggtggcctaatttannnnnnncacaccgggtgtatgtatagaaaaacttgattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42097569 |
cataggcataggtccaatttgtgacgacctagagctcaagtttgtaggtggcctaatttatttttttcacaccgggtgtatgtatagaaaaacttgattt |
42097668 |
T |
 |
| Q |
114 |
acatggtgtgttatatagaaaatctcaccggtaggcccaaacatgaacaaagtttttacccctaatgatatttttgctgagaatttcttttttcacactc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42097669 |
acatggtgtgttatatagaaaatctcaccggtaggcccaaacatgaacaaagtttttactcctaatgatatttttgctgagaatttcttttttcacactc |
42097768 |
T |
 |
| Q |
214 |
atcacttctcgcacgccctccataattttcaaaacaacctc |
254 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
42097769 |
atcacttctcacacgccctccataatttccaaaacatcctc |
42097809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University