View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_low_15 (Length: 223)
Name: NF12502_low_15
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 41127232 - 41127030
Alignment:
| Q |
5 |
agggtccctccctatgtctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41127232 |
agggtccctccctatgtctgccaccatgaaattcactaccacatttttaggcagcaagtaaccgtcgaaaaccacatcctccttcaccgcatggggcaac |
41127133 |
T |
|
| Q |
105 |
acaaagtgccccggtgggtgacgcctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctctttaatttccttattctctt |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127132 |
acaaagtgccccggtgggtgacacctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctctttaatttccttattctctt |
41127033 |
T |
|
| Q |
205 |
cat |
207 |
Q |
| |
|
||| |
|
|
| T |
41127032 |
cat |
41127030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 26506825 - 26506761
Alignment:
| Q |
21 |
tctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctc |
85 |
Q |
| |
|
||||||||||| ||||| ||| | |||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
26506825 |
tctgccaccataaaattaactgtcccatttttaggcaccaagtaaccgttaaaaatcacatcctc |
26506761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 26494786 - 26494710
Alignment:
| Q |
15 |
cctatgtctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcac |
91 |
Q |
| |
|
||||| ||||||||||| |||||||| | |||||||||||| ||||||||| || ||||| | ||||||| |||| |
|
|
| T |
26494786 |
cctatatctgccaccataaaattcacagtcccatttttaggcaccaagtaaccattcaaaacaatatcctccgtcac |
26494710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 2303654 - 2303468
Alignment:
| Q |
1 |
cacgagggtccctccctatgtctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatgggg |
100 |
Q |
| |
|
||||||| |||| ||| || || |||| |||||||||||| | |||||||||||| ||| |||||||| |||||||||||||| |||||||| || || |
|
|
| T |
2303654 |
cacgaggatcccaccccatctccgccagcatgaaattcaccgtcccatttttaggcaccaaataaccgttcaaaaccacatcctctttcaccgcgtgtgg |
2303555 |
T |
|
| Q |
101 |
caacacaaagtgccccggtgggtgacgcctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||| ||||||||||| ||||| || | ||| | || |||||||| ||||||||||| |
|
|
| T |
2303554 |
caacagaaaatgccccggtggatgacgcctcaacccttccaaaacaacacatttcaaataccgaagtttctgcaattcttcctcttt |
2303468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 21 - 187
Target Start/End: Complemental strand, 2327189 - 2327023
Alignment:
| Q |
21 |
tctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtg |
120 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||| ||||| || ||||||||||| || |||| ||||| ||||||||||| ||||| |||| |
|
|
| T |
2327189 |
tctgccaccatgaaattcaccgtcccatttttaggcaccaaataaccattcaaaaccacatcatcgctcactgcatgaggcaacacaaaatgccctggtg |
2327090 |
T |
|
| Q |
121 |
ggtgacgcctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
| |||||||||| ||||||||||| ||||||||| | ||| | || || ||||||||||||||||| |
|
|
| T |
2327089 |
gatgacgcctcaacccttccaaaaccacacacttcaaataccgaagtttatgcaagtcttcctcttt |
2327023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 48 - 187
Target Start/End: Complemental strand, 2293994 - 2293855
Alignment:
| Q |
48 |
tttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaatca |
147 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||| |||||||| || |||||| ||| | ||||||||| |||||||||| ||||||||||| || |
|
|
| T |
2293994 |
tttttaggcaccaaataaccgtccaaaaccacatcctctttcaccgcgtgtggcaacggaaatttccccggtggatgacgcctcaacccttccaaaacca |
2293895 |
T |
|
| Q |
148 |
cacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
||||||| | ||| | || |||||||||||||||||||| |
|
|
| T |
2293894 |
cacacttcaaataccgaagtttctgcaagtcttcctcttt |
2293855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 29 - 187
Target Start/End: Complemental strand, 2321328 - 2321169
Alignment:
| Q |
29 |
catgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgcccc-ggtgggtgacg |
127 |
Q |
| |
|
|||||||||||| | |||||||||||| ||| |||||||| |||||||||||||| ||||||| || | ||||||||| |||||| ||||| ||||| |
|
|
| T |
2321328 |
catgaaattcaccgtcccatttttaggcaccaaataaccgttcaaaaccacatcctctttcaccgtgtgtgccaacacaaaatgcccctggtggatgacg |
2321229 |
T |
|
| Q |
128 |
cctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
||||| ||||||||||| ||| ||||| | |||| | || |||||||||| ||||||||| |
|
|
| T |
2321228 |
cctcatcccttccaaaaccacgcacttcaaatatcgaagtttctgcaagttttcctcttt |
2321169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 2351230 - 2351044
Alignment:
| Q |
1 |
cacgagggtccctccctatgtctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatgggg |
100 |
Q |
| |
|
||||||| |||| ||| || ||||||||||| ||||| || | |||||||||||| ||| |||||||| |||| ||||||||| ||||||| || || |
|
|
| T |
2351230 |
cacgaggatcccaccccatctctgccaccataaaattgaccgtcccatttttaggcaccaaataaccgttaaaaagcacatcctctgtcaccgcgtgtgg |
2351131 |
T |
|
| Q |
101 |
caacacaaagtgccccggtgggtgacgcctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||||||||||| |||||| || ||||| || |||||||| ||||||||||| |
|
|
| T |
2351130 |
caacacattatgccccggtggatgacgcctcaacccttccaaaaccacacatttcagatacaaaagtttctgcaaatcttcctcttt |
2351044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 48 - 187
Target Start/End: Complemental strand, 2310325 - 2310186
Alignment:
| Q |
48 |
tttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaatca |
147 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||| |||||||| || |||||| ||| | ||||| ||| |||||||||| ||||||||||| || |
|
|
| T |
2310325 |
tttttaggcaccaaataaccgtccaaaaccacatcctctttcaccgcgtgtggcaacggaaatttccccgatggatgacgcctcaacccttccaaaacca |
2310226 |
T |
|
| Q |
148 |
cacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
||||||| | ||| || |||||||||||||||||||| |
|
|
| T |
2310225 |
cacacttcaaataccaaagtttctgcaagtcttcctcttt |
2310186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 2330924 - 2330738
Alignment:
| Q |
1 |
cacgagggtccctccctatgtctgccaccatgaaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatgggg |
100 |
Q |
| |
|
||||||||||| ||| || ||||| ||||| |||||||| | ||| |||||||| ||| ||||| || |||||||||||||| |||| || || || |
|
|
| T |
2330924 |
cacgagggtccaaccccatctctgcaaccataaaattcaccgtcccatctttaggcaccaaataaccattcaaaaccacatcctcgctcactgcgtgagg |
2330825 |
T |
|
| Q |
101 |
caacacaaagtgccccggtgggtgacgcctcagcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctcttt |
187 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||| ||||||||||| ||| ||||| | ||| | || || ||||||||||||||||| |
|
|
| T |
2330824 |
caacacgaaatgccctggtggatgacgcctcaacccttccaaaaccacgcacttcaaataccgaagtttatgcaagtcttcctcttt |
2330738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University