View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_low_17 (Length: 211)
Name: NF12502_low_17
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 39300020 - 39299848
Alignment:
| Q |
20 |
agagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgcagaaggcatgaaagaaagaggtgaaggtttgggagatattggtggaagagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300020 |
agagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgcagaaggcatgaaagaaagaggtgaaggtttgggagatattggtggaagagg |
39299921 |
T |
 |
| Q |
120 |
annnnnnnnnnnnnnccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttac |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299920 |
aagagaaagagagagccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttac |
39299848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University