View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12502_low_2 (Length: 450)
Name: NF12502_low_2
Description: NF12502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12502_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 6e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 21 - 171
Target Start/End: Original strand, 17003296 - 17003446
Alignment:
| Q |
21 |
gatacggaaatttcagaaaagctgtacctttgttaggaattctggagtataaattctacctcgaggcccagatggaggatttcgtggagtatactttcca |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17003296 |
gatacggaaatttcagaaaagttgtacctttgttaagaattctggagtataaattctacctcgaggcccagatggaggatttcgtggagtatactttcca |
17003395 |
T |
 |
| Q |
121 |
gtaagaacacctgcttaagataacgattttgcataaattttgcggctatta |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17003396 |
gtaagaacacctgcttaagataacgattttgcataaattttgcggctatta |
17003446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University