View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12503_low_2 (Length: 375)
Name: NF12503_low_2
Description: NF12503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12503_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 38 - 199
Target Start/End: Original strand, 34500246 - 34500407
Alignment:
| Q |
38 |
acatcaaaaataaattgaggtatcaccaataacaaccatgaatagtacatagaagtacatagaagcacatagaagcatagacaacaataacacgtttcaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34500246 |
acatcaaaaataaattgaggtatcaccaataataaccatgaatagtacatagaagtacatagaagcacatagaagcatagacaacgataacacgtttcaa |
34500345 |
T |
 |
| Q |
138 |
attcaatgtattgcaccttgcactttgatcaagaagttggcaacaaagctagtttaggaagg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500346 |
attcaatgtattgcaccttgcactttgatcaagaagttggcaacaaagctagtttaggaagg |
34500407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 262 - 375
Target Start/End: Original strand, 34500470 - 34500583
Alignment:
| Q |
262 |
ccaagttatgtaagctttaactagcacctagagcaaataggatcataacgcatagaagcagatgtagtgaagcagcaacaaattacagcagtccatgtaa |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500470 |
ccaagttatgtaagctttaactagcacctagagcaaataggatcataacacatagaagcagatgtagtgaagcagcaacaaattacagcagtccatgtaa |
34500569 |
T |
 |
| Q |
362 |
ccaggaccaaaaat |
375 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34500570 |
ccaggaccaaaaat |
34500583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University