View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12506_low_4 (Length: 263)
Name: NF12506_low_4
Description: NF12506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12506_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 125 - 250
Target Start/End: Complemental strand, 32312019 - 32311894
Alignment:
| Q |
125 |
atgtagggttgagtggttatataggtggaggaagttatggaagactagatctcaaccgttggatgtcagattttgaaagaggaagaataaagcgcgcaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32312019 |
atgtagggttgagtggttatataggtggaggaagttatggaagactagatctcaaccgttggatgtcagattttgaaagaggaagaataaagcgcgcaaa |
32311920 |
T |
 |
| Q |
225 |
taggagggagtgatgtatatataatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32311919 |
taggagggagtgatgtatatataatt |
32311894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University