View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12507_low_4 (Length: 225)
Name: NF12507_low_4
Description: NF12507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12507_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 52876186 - 52876378
Alignment:
| Q |
18 |
ataacatatgtcttatttcttctcataaaaagtaaaatatttgttcttttttcatattgtgtgcttgttaacttttcatttgtttttcaaatttatgagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876186 |
ataacatatgtcttatttcttctcataaaaagtaaaatatttgttcttttttcatattgtgtgcttgttaacttttcatttgtttttcaaatttatgagc |
52876285 |
T |
 |
| Q |
118 |
agcaaacgtcccaattttggtcagaagactgtgaatttacctatgtttggagagatttctattttctcactggtggtgttgctattctctgtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876286 |
agcaaacgtcccaattttggtcagaagactgtgaatttacctatgtttggagagatttctattttctcactggtggtgttgctattctctgtg |
52876378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 190
Target Start/End: Complemental strand, 256480 - 256424
Alignment:
| Q |
134 |
ttggtcagaagactgtgaatttacctatgtttggagagatttctattttctcactgg |
190 |
Q |
| |
|
||||||| ||||| |||||| ||||| | ||||| ||||||||||||||||| |||| |
|
|
| T |
256480 |
ttggtcaaaagaccgtgaatgtacctctatttggggagatttctattttctcgctgg |
256424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University