View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12508_high_11 (Length: 225)
Name: NF12508_high_11
Description: NF12508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12508_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 1562402 - 1562195
Alignment:
| Q |
8 |
gagtagcataggtaagacagtgctcagattctagactcaaa-gtaaacttatgcactacatttatctttgctgaattcatattaaagagcaaaataaaaa |
106 |
Q |
| |
|
||||| ||| |||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562402 |
gagtatcattggtaagacggtgctcacattctagactcaaaagtaaacttatgcactacatttatctttgctgaattcatattaaagagcaaaataaaaa |
1562303 |
T |
|
| Q |
107 |
caaaatagatcaaactgttaatgatggaaactttaaatcaaaagactcgtagcaaatacatatgaattaaaagggaaaaggacaccttaaacacagcata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
1562302 |
caaaatagatcaaactgttaatgatggaaactttaaatcaaaagactcgtagcaaatacatatgaattaaaaggtaaaaggacaccttaaacacagccta |
1562203 |
T |
|
| Q |
207 |
cagtgaac |
214 |
Q |
| |
|
||| |||| |
|
|
| T |
1562202 |
cagagaac |
1562195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University