View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12508_low_13 (Length: 213)
Name: NF12508_low_13
Description: NF12508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12508_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 38931477 - 38931593
Alignment:
| Q |
20 |
caatgtgcaaacggtttcatcgaagaagttgtgttgttcttcatgttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaa |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931477 |
caatgtgcaaacagtttcatcgaagaagttgtgttgtccttcatgttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaa |
38931576 |
T |
|
| Q |
120 |
tgctctttagtttttgt |
136 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38931577 |
tgctctttagtttttgt |
38931593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University