View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12508_low_13 (Length: 213)

Name: NF12508_low_13
Description: NF12508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12508_low_13
NF12508_low_13
[»] chr7 (1 HSPs)
chr7 (20-136)||(38931477-38931593)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 38931477 - 38931593
Alignment:
20 caatgtgcaaacggtttcatcgaagaagttgtgttgttcttcatgttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaa 119  Q
    |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38931477 caatgtgcaaacagtttcatcgaagaagttgtgttgtccttcatgttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaa 38931576  T
120 tgctctttagtttttgt 136  Q
    |||||||||||||||||    
38931577 tgctctttagtttttgt 38931593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University