View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12508_low_8 (Length: 277)
Name: NF12508_low_8
Description: NF12508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12508_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 361187 - 360938
Alignment:
| Q |
18 |
ctgggttataatgatacaacaattgattgttcaggttgcttcaaccattgtgtattcagtcactggtggaaaatcacttaagaagttctgtgaaataatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361187 |
ctgggttataatgatacaacaattgattgttcaggttgcttcaaccattgtgtattcagtcactggtggaaaatcacttaagaagttctgtgaaataatg |
361088 |
T |
 |
| Q |
118 |
actccaataatgccaatgtttgatgaaattagacaaacatattatatttgcttctttgtttgtatacagttactcctttcacaaattcctaacttcaata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361087 |
actccaataatgccaatgtttgatgaaattagacaaacatattatatctgcttctttgtttgtatacagttactcctttcacaaattcctaacttcaata |
360988 |
T |
 |
| Q |
218 |
ctttaaaaggaatctcgttgctcgcggcattcatgtctgtttggtctgtg |
267 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
360987 |
ctttaaaaggaatctcgctgctcgcggcattcatgtctgtttggtatgtg |
360938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University