View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12509_high_3 (Length: 421)
Name: NF12509_high_3
Description: NF12509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12509_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 6 - 406
Target Start/End: Complemental strand, 45001913 - 45001512
Alignment:
| Q |
6 |
agaagcagagagagattccagttccacatattgcaacaacaaacgatgatgaaatggttggtagaagaagaagcaaccgtttaatgaatacaaaacaaac |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001913 |
agaagtagagagagattccagttccacatattgcaacagcaaacgatgatgaaatggttggtagaagaagaagcaaccgtttaatgaatacaaaacaaac |
45001814 |
T |
|
| Q |
106 |
aagtctgctgcctcactgtcagatgaatatggcgacggtggccctgaaagcaccatttcatcaggaagagcgacccgtgcgggtgctttgaaacggtgag |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | || | |||||||||||||||||||||| |
|
|
| T |
45001813 |
aagtatgctgcctcactgtcagatgaatatggcgacggtggcccagaaagcaccatttcatcaggaagaacaacatgcgcgggtgctttgaaacggtgag |
45001714 |
T |
|
| Q |
206 |
tggcgaagcaacaggtggccagc-cgagcgcaatgagaaggacgacaacggaggagggaggagaatccattgcggcaaagttacagcatgcgaatgcggg |
304 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45001713 |
tggcgaagcaacaggtggccatcgcgagcgcaatgagaaggacgacaatggaggagggaggagaatccattgcggcaaagttacagcatacgaatgcggg |
45001614 |
T |
|
| Q |
305 |
ggaatgtataaatactgacaacatcgttgcaattcctcttcattgctaatttgggattctttagtggaagaagaaaagactctatcttcatttcattatt |
404 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001613 |
ggaatgtataaatactgatagcatcgttgcaattcctcttcattgctaatttgggattctttagtggaagaagaaaagactctatcttcatttcattatt |
45001514 |
T |
|
| Q |
405 |
tc |
406 |
Q |
| |
|
|| |
|
|
| T |
45001513 |
tc |
45001512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University