View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12509_low_10 (Length: 207)
Name: NF12509_low_10
Description: NF12509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12509_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 9550325 - 9550135
Alignment:
| Q |
1 |
tgtaatgttcaggtttcgggattctaatgcagaggtttctcagttaaattatcctgcatttaagacaacacagtcagggagatttagaagtacaataagt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9550325 |
tgtaatgttcaggtttcaggattctaatgcagaggtttctcagagaaattatcctgcatttaagacaacacagtcagggagatttagaagtacaataagt |
9550226 |
T |
|
| Q |
101 |
tcattttctgagaagtttcaaaggggacttgaatctggttctgagaggataaagaggttcagatcaacgtttgaccattatccctatgaca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9550225 |
tcattttctgagaagtttcaaaggggacttgaatctggttctgagaggataaagaggttcagatcaacgtttgaccattatcactatgaca |
9550135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 41389493 - 41389534
Alignment:
| Q |
113 |
aagtttcaaaggggacttgaatctggttctgagaggataaag |
154 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
41389493 |
aagtttcaaaggggatttgagtctagttctgagaggataaag |
41389534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University