View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12509_low_2 (Length: 494)
Name: NF12509_low_2
Description: NF12509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12509_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 43285827 - 43285680
Alignment:
| Q |
1 |
taataatcatttcagattaggtctaataaaatagactagactatacaatttagtaaacaaaagtttgtatcttaactacaagatataccaatatttaatg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43285827 |
taataatcattttagattaggtctaataaaatagactagactatacaatttagtaaacaaaagtttgtatcttaattacaagatataccaatatttaatg |
43285728 |
T |
|
| Q |
101 |
tcatcatgccctaaccaaaattatttttagt--agaaaatttatgaag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43285727 |
tcatcatgccctaaccaaaattatttttagtagagaaaatttatgaag |
43285680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 272 - 313
Target Start/End: Complemental strand, 43285645 - 43285604
Alignment:
| Q |
272 |
agtatataatgatgataaatataaaccccctcgtgcatatcc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285645 |
agtatataatgatgataaatataaaccccctcgtgcatatcc |
43285604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 436 - 476
Target Start/End: Complemental strand, 43285481 - 43285441
Alignment:
| Q |
436 |
catgccttggtgtcagatatacccacgtgaggcctcactgc |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285481 |
catgccttggtgtcagatatacccacgtgaggcctcactgc |
43285441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University