View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12509_low_9 (Length: 213)
Name: NF12509_low_9
Description: NF12509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12509_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 2323474 - 2323655
Alignment:
| Q |
13 |
caaagggagaagaagtaaatgaatttgcctaacactaccatcgttttgtcaagtctcataataataaataaaagagtatgataaaagaataatcttgttc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2323474 |
caaacggagaagaagtaaatgaattttcctaacactaccatcgttttgtcaagtctcataataataaataaaagagtatgataaaagaataatcttgttc |
2323573 |
T |
 |
| Q |
113 |
aatgtttttgattacacagctatatatgacgtaacactatagcagccaattttctaacatcaaaacttgataatttgtgggtgattt |
199 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
2323574 |
aatgttttt-attacactgc----tatgacgtaacactatagcagccaattttatgacatcaaaacttgataatttgtgtgtgattt |
2323655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University