View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_high_100 (Length: 214)
Name: NF1250_high_100
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_high_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 34857256 - 34857144
Alignment:
| Q |
1 |
ccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactattaaagttggtaactgttatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34857256 |
ccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactattaaagtttgtaactgttatgca |
34857157 |
T |
 |
| Q |
101 |
gcctacctatgat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34857156 |
gcctacctatgat |
34857144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University