View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_high_51 (Length: 311)
Name: NF1250_high_51
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 29 - 227
Target Start/End: Original strand, 15505961 - 15506147
Alignment:
| Q |
29 |
cagagaggacaatttattcatgcatgtgtataatgtaagttcaataatgctgctaactacctttcaaattgtaacatgatagttgaattttcaaatcaat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15505961 |
cagagaggacaatttattcatgcatgtgtataatgtaagttcaataatgctgctaactacctttcaaattgtatcatgatagttgaattttcaaatcaat |
15506060 |
T |
 |
| Q |
129 |
tttttatgattttctgtccaattttctgtctattaaaaatgatggctaattgtttgaggaatgataagatgataaacattcaattttaatggacagatg |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15506061 |
tttttatg------------attttctgtctattaaaaatgatggctaattgtttgaggaatgataagatgataaacattcaattttaatggacagatg |
15506147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University