View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_high_90 (Length: 224)
Name: NF1250_high_90
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_high_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 55329538 - 55329678
Alignment:
| Q |
1 |
ctttcagccgcattgcttatcccattcccgttaacccctctgttcaatttgtctatcttttctgtaatttgattaccaaaacactgcttctcgagaag-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329538 |
ctttcagccgcattgcttatcccattcccgttaacccctctgttcaatttgtctatcttttctgtaatttgattaccaaaacactgcttctcgagaagaa |
55329637 |
T |
 |
| Q |
99 |
----aagaacaacaactctaatatcaaacttcttgatgatg |
135 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55329638 |
caacaacaacaacaactctaatatcaaacttcttgatgatg |
55329678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University