View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_high_94 (Length: 219)
Name: NF1250_high_94
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_high_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 3568706 - 3568586
Alignment:
| Q |
1 |
gccgagttagcaagatcattctgctgatgcgccaatgtgggtgaggagccagaagggcgtattccttcaatcgtgtggtctatgcacacttcctcttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3568706 |
gccgagttagcaagatcattctgctgatgcgccaatgtgggtgaggagccagaagggcgtattccttcaatcatgtggtctatgcacacttcctcttggg |
3568607 |
T |
 |
| Q |
101 |
agaaatgttggaccagcaaag |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3568606 |
agaaatgttggaccagcaaag |
3568586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University